View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_76 (Length: 246)
Name: NF1711_high_76
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_76 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 10031885 - 10031655
Alignment:
Q |
1 |
attataaaatatcataatagaactcaagctataagtatttatctgtactttatttcacacnnnnnnn-gtatttatttctaaattatttttatagttaaa |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
10031885 |
attataaaatatcataatagaactcaagctataagtatttatttgtactttatttcacacaaaaaaaagtatttatttctaaattatttttatagttaaa |
10031786 |
T |
|
Q |
100 |
gagaaatttcatatttttacatacgttgtaagttcatttcataaatgtttttggagaatttatttatataatcattaatcatggatcaatgacataatag |
199 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10031785 |
gagaaatttcatatttttacataagttgtaagttcatttcataaatgtttttggagaatttatttatataatcattaatcatggatcaatgacataatag |
10031686 |
T |
|
Q |
200 |
atctgcaacgaacttaagatcaacactctct |
230 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
10031685 |
atctgcaacgaacttaagatcaacactctct |
10031655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9765 times since January 2019
Visitors: 7932