View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1711_high_84 (Length: 237)

Name: NF1711_high_84
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1711_high_84
NF1711_high_84
[»] chr7 (1 HSPs)
chr7 (147-221)||(36429191-36429263)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 147 - 221
Target Start/End: Complemental strand, 36429263 - 36429191
Alignment:
147 atttaggtttatgagtcaaaaaataatactaataaagtagttttatttatgggaataaagtaattgggttatacc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
36429263 atttaggtttatgagtcaaaaaataatactaataaagtagttttatttatgggaataaagtaa--gggttatacc 36429191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16079 times since January 2019
Visitors: 3757