View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_84 (Length: 237)
Name: NF1711_high_84
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_84 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 147 - 221
Target Start/End: Complemental strand, 36429263 - 36429191
Alignment:
Q |
147 |
atttaggtttatgagtcaaaaaataatactaataaagtagttttatttatgggaataaagtaattgggttatacc |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
36429263 |
atttaggtttatgagtcaaaaaataatactaataaagtagttttatttatgggaataaagtaa--gggttatacc |
36429191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16079 times since January 2019
Visitors: 3757