View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1711_high_92 (Length: 232)

Name: NF1711_high_92
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1711_high_92
NF1711_high_92
[»] chr4 (1 HSPs)
chr4 (12-232)||(54252377-54252597)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 54252597 - 54252377
Alignment:
12 agatccaacaatgtttcatattttactgcagatttcttctatggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54252597 agatccaacaatgtttcatattttactgcagatttcttctatggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaa 54252498  T
112 tgtgtactcggnnnnnnnnnnnnnnnnnnnatgttgttgttttgctttttgattatcattatcatgttgttcttgtacgttgttggtgatattggctaca 211  Q
    |||||||| ||                   |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
54252497 tgtgtacttggtcttcttcttcttcttcttatgttgttgttttgctttttgattatcattatgatgttattcttgtacgttgttggtgatattggctaca 54252398  T
212 cggctcaatctgttagcttag 232  Q
    |||||||||||||||||||||    
54252397 cggctcaatctgttagcttag 54252377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 14109 times since January 2019
Visitors: 8375