View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_92 (Length: 232)
Name: NF1711_high_92
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_92 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 54252597 - 54252377
Alignment:
Q |
12 |
agatccaacaatgtttcatattttactgcagatttcttctatggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaa |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54252597 |
agatccaacaatgtttcatattttactgcagatttcttctatggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaa |
54252498 |
T |
|
Q |
112 |
tgtgtactcggnnnnnnnnnnnnnnnnnnnatgttgttgttttgctttttgattatcattatcatgttgttcttgtacgttgttggtgatattggctaca |
211 |
Q |
|
|
|||||||| || |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
T |
54252497 |
tgtgtacttggtcttcttcttcttcttcttatgttgttgttttgctttttgattatcattatgatgttattcttgtacgttgttggtgatattggctaca |
54252398 |
T |
|
Q |
212 |
cggctcaatctgttagcttag |
232 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
54252397 |
cggctcaatctgttagcttag |
54252377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14109 times since January 2019
Visitors: 8375