View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1711_low_103 (Length: 227)

Name: NF1711_low_103
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1711_low_103
NF1711_low_103
[»] chr1 (1 HSPs)
chr1 (1-217)||(52808005-52808221)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 52808005 - 52808221
Alignment:
1 gtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtttatggatgaaacctggcaattatggtattttgctgtggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||    
52808005 gtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtctatggatgaaacctggcaattatggtattttgttgtggt 52808104  T
101 gcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagttacaaacaaagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52808105 gcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagttacaaacaaagt 52808204  T
201 ttaagttacagcctatg 217  Q
    |||||||||||||||||    
52808205 ttaagttacagcctatg 52808221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 11342 times since January 2019
Visitors: 8091