View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_103 (Length: 227)
Name: NF1711_low_103
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_103 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 52808005 - 52808221
Alignment:
Q |
1 |
gtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtttatggatgaaacctggcaattatggtattttgctgtggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
T |
52808005 |
gtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtctatggatgaaacctggcaattatggtattttgttgtggt |
52808104 |
T |
|
Q |
101 |
gcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagttacaaacaaagt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52808105 |
gcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagttacaaacaaagt |
52808204 |
T |
|
Q |
201 |
ttaagttacagcctatg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
52808205 |
ttaagttacagcctatg |
52808221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11342 times since January 2019
Visitors: 8091