View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_109 (Length: 217)
Name: NF1711_low_109
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_109 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 5482176 - 5481995
Alignment:
Q |
19 |
tatgaagatgtgtaagtaaccagattagttcacaagagttgcaccaacaaaaacaagttcatcagagtaattttaattttacaaaaggaatttaaaatga |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5482176 |
tatgaagatgtgtaagtaaccagattagttcacaagagttgcaccaacaaaaacaagttcatcagagtaattttaattttacaaaaggaatttaaaatga |
5482077 |
T |
|
Q |
119 |
ttggaaatttgaaatgagaatacaataatcgaagtgtaaatgacttcacccttaacatgaataactttcaactacattgaac |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5482076 |
ttggaaatttgaaatgagaatacaataatcgaagtgtaaatgacttcacccttaacatgaataactttcaactacattgaac |
5481995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14578 times since January 2019
Visitors: 8422