View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1711_low_109 (Length: 217)

Name: NF1711_low_109
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1711_low_109
NF1711_low_109
[»] chr5 (1 HSPs)
chr5 (19-200)||(5481995-5482176)


Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 5482176 - 5481995
Alignment:
19 tatgaagatgtgtaagtaaccagattagttcacaagagttgcaccaacaaaaacaagttcatcagagtaattttaattttacaaaaggaatttaaaatga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5482176 tatgaagatgtgtaagtaaccagattagttcacaagagttgcaccaacaaaaacaagttcatcagagtaattttaattttacaaaaggaatttaaaatga 5482077  T
119 ttggaaatttgaaatgagaatacaataatcgaagtgtaaatgacttcacccttaacatgaataactttcaactacattgaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5482076 ttggaaatttgaaatgagaatacaataatcgaagtgtaaatgacttcacccttaacatgaataactttcaactacattgaac 5481995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 14578 times since January 2019
Visitors: 8422