View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_23 (Length: 420)
Name: NF1711_low_23
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 6 - 195
Target Start/End: Original strand, 29257321 - 29257506
Alignment:
| Q |
6 |
gatatttgtacgaatgaataatagtatgatctttttgtttcctaaaatactaactcaatatcaaatgtaaataggaggtttacgggttaaaaaggataga |
105 |
Q |
| |
|
|||||||||| |||| ||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29257321 |
gatatttgtatgaataaataata---tgat-tttttgtttcctaaaatactgactcaatatcaaatgtaaataggaggtttacgggttaaaaaggataga |
29257416 |
T |
|
| Q |
106 |
aaaatgagaggaggagaggagatctgtaaaagctagcaagcaatctggtaaaccactttactttactttctgtaatttcaatacttctga |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29257417 |
aaaatgagaggaggaaaggagatctgtaaaagctagcaagcaatctggtaaaccactttactttactttctgtaatttcaatgcttctga |
29257506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 300 - 404
Target Start/End: Original strand, 29257605 - 29257709
Alignment:
| Q |
300 |
atgtatgattacattaaaccactgtgctaagtaataaaatcccatttttagcagttcaaatgatttatctcaataccaatttctgtttgttcatatccaa |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29257605 |
atgtatgattacattaaaccactgtgctaagtaataaaatcccatttttagcagttcaaaggatttatctcaataccaatttctgtttgttcatatccaa |
29257704 |
T |
|
| Q |
400 |
tgttt |
404 |
Q |
| |
|
||||| |
|
|
| T |
29257705 |
tgttt |
29257709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11627 times since January 2019
Visitors: 8091