View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_45 (Length: 334)
Name: NF1711_low_45
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_45 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 11 - 316
Target Start/End: Original strand, 13610205 - 13610510
Alignment:
Q |
11 |
agaatataaggctgaagtagaagcaatgacaacattgagggctgaagctttagcaaagatgactcgccttaaattgctcaagctgtgtgatttgaatttc |
110 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
13610205 |
agaaaataaggctgaagtagaagcaatgacaacattgagggctgaagctttagcaaagatgactcgccttaaattgctcaagctgcgtgatttgaatttc |
13610304 |
T |
|
Q |
111 |
tcaggaagtctcaattttctttcaagtgaattggggtatctatattgggaaaaatatcctttcacatgtttgccatcaagttttcagccggataaacttg |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13610305 |
tcaggaagtctcaattttctttcaagtgaattggggtatctatattgggaaaaatatcctttcacatgtttgccatcaagttttcagccggataaacttg |
13610404 |
T |
|
Q |
211 |
ttgaattgatcctacgttctagcaacatcaggcaactatggaagggaacaaaggtactacaatcctatggttacgagtatgggtaaaatggatggaatgg |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
13610405 |
ttgaattgatcctacgttctagcaacatcaggcaactatggaagggaacaaaggtactacaatcatatggttacgagtatgggtaaaatggatggaatgg |
13610504 |
T |
|
Q |
311 |
atgaat |
316 |
Q |
|
|
|||||| |
|
|
T |
13610505 |
atgaat |
13610510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 36 - 266
Target Start/End: Original strand, 31246176 - 31246406
Alignment:
Q |
36 |
atgacaacattgagggctgaagctttagcaaagatgactcgccttaaattgctcaagctgtgtgatttgaatttctcaggaagtctcaattttctttcaa |
135 |
Q |
|
|
|||||||||||||| |||||||||||||| | |||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| | |
|
|
T |
31246176 |
atgacaacattgagaactgaagctttagcacaaatgagtcgccttaaattgctcatgctgtggaatttgaatttctcaggaagtctcaattttctttcta |
31246275 |
T |
|
Q |
136 |
gtgaattggggtatctatattgggaaaaatatcctttcacatgtttgccatcaagttttcagccggataaacttgttgaattgatcctacgttctagcaa |
235 |
Q |
|
|
|| | ||||||||||| | |||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||| || |||||| | |||||| |
|
|
T |
31246276 |
gtcatttggggtatctctgttgggataaatatcctttcacttgtttgccatcaagtttccagccggataaacttgttgaactggtcctacctcgtagcaa |
31246375 |
T |
|
Q |
236 |
catcaggcaactatggaagggaacaaaggta |
266 |
Q |
|
|
|||||||||||||||| |||| ||||||||| |
|
|
T |
31246376 |
catcaggcaactatgggagggcacaaaggta |
31246406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9862 times since January 2019
Visitors: 7932