View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_46 (Length: 333)
Name: NF1711_low_46
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 16 - 321
Target Start/End: Complemental strand, 7108558 - 7108253
Alignment:
| Q |
16 |
attttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacattgagaagaggaaattagtcattgtggcatggaaaaaattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7108558 |
attttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacattgagaagaggaaattagtcattgtggcatgaaaaaaattt |
7108459 |
T |
|
| Q |
116 |
gtaagccattagaggagggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgagagaatggcgtcttctgata |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7108458 |
gtaagccattagaggaaggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgggagaatggcgtcttctgata |
7108359 |
T |
|
| Q |
216 |
cggatcgggcaaagatgttaaggtctagagttttaaaaaacgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagta |
315 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108358 |
cggattgggcaaagatgttaaggtctagagttttaaaaaatgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagta |
7108259 |
T |
|
| Q |
316 |
taatct |
321 |
Q |
| |
|
|||||| |
|
|
| T |
7108258 |
taatct |
7108253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8524 times since January 2019
Visitors: 7803