View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_48 (Length: 315)
Name: NF1711_low_48
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 10 - 299
Target Start/End: Complemental strand, 47472812 - 47472523
Alignment:
| Q |
10 |
attattctcattgttgttgtggttttgatctggttgtcgttttttgttaagaagcttttgactgggaaaacattgttgcatgatcccagggtttggttgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47472812 |
attattctcattgttgttgtggttttgatctggttgtcgttttttgttaagaagcttttgactgggaaaacattgttgcatgatcctagggtttggttgg |
47472713 |
T |
|
| Q |
110 |
ctggttctgtttttgtttacttttttagtgtttctggtgcaatgcataacattataaggaaaatgcctatgtttcttcaggatcgtaacgatccttcgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47472712 |
ctggttctgtttttgtttacttttttagtgtttctggtgcaatgcataacattataaggaaaatgcctatgtttcttcaggatcgtaacgatccttcgaa |
47472613 |
T |
|
| Q |
210 |
gcttgtgtttttctatcagggatctggaatgcagcttggtgctgagggttttactgttggattcttgtatacacttgtgggtttgctttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47472612 |
gcttgtgtttttctatcagggatctggaatgcagcttggtgctgagggttttactgttggattcttgtatacacttgtgggtttgctttt |
47472523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11641 times since January 2019
Visitors: 8091