View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_57 (Length: 293)
Name: NF1711_low_57
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_57 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 277
Target Start/End: Complemental strand, 47063431 - 47063166
Alignment:
Q |
9 |
agcataggtctgattttatgtacgattgatcagaatgaaactgaaatgacaaaaataccaatacattagcatccaaatgtatattgcttgagaagatttt |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
47063431 |
agcataggtctgattttatgtacgattgatcagaatgaaactgaaatgacaaaaataccaatacattagcatccaaatgtatattgtttgagaagatttt |
47063332 |
T |
|
Q |
109 |
ctaataaaaaagcacaacaacactgtaacaattgatgaaaactaggggagacaagagtgggaggacaagagcgtgcgtttgtgattgtgatcgtccatct |
208 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
47063331 |
ctaataaaaaagcacaaca---ctgtaacaattgatgaaaactaggggagacaagagtgggaggacaagagtgtgcgtttgtgattgtgatcgtccatct |
47063235 |
T |
|
Q |
209 |
tattattattggatgcaaggaattgtatagagagatactgactgtgagtttgcaaggaattgaaaaata |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
47063234 |
tattattattggatgcaaggaattgtatagagagatactgaatgtgagtttgcaaggaattgaaaaata |
47063166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12965 times since January 2019
Visitors: 8270