View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_60 (Length: 284)
Name: NF1711_low_60
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 44242814 - 44242951
Alignment:
| Q |
1 |
aaacatggaagaaaagacaaaattaatcccaacagaagaaataaaagcagtctaacaaacaattgagtttgatatgatgaggaggaatcttcaaataatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44242814 |
aaacatggaagaaaagacaaaattaatcccaacagaagaaataaaagcagtctaacaaacaattgagtttgatatgatgag--ggaatcttcaaataatg |
44242911 |
T |
|
| Q |
101 |
aagggcaaaaaggggaataattaagacaaattttagcaca |
140 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44242912 |
aaggccaaaaaggggaataaataagacaaattttagcaca |
44242951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 201 - 263
Target Start/End: Original strand, 44243503 - 44243565
Alignment:
| Q |
201 |
aacatcaaggattagatctgagtaatttttatggcaattgttgtataaagcgtgggagtcatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44243503 |
aacatcaaggattagatctgagtaatttttatggcaattgttgtataaagcgtgggagtcatt |
44243565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 177
Target Start/End: Complemental strand, 1525314 - 1525277
Alignment:
| Q |
140 |
attttgaatcaagtgatatatgccaaaacatgtcatca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1525314 |
attttgaatcaagtgatatatgccaaaacatgttatca |
1525277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 175
Target Start/End: Complemental strand, 610133 - 610099
Alignment:
| Q |
141 |
ttttgaatcaagtgatatatgccaaaacatgtcat |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
610133 |
ttttgaatcaagtgatatatgccaaagcatgtcat |
610099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12449 times since January 2019
Visitors: 8218