View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_62 (Length: 283)
Name: NF1711_low_62
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_62 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 52066275 - 52066081
Alignment:
Q |
10 |
catcatcatgaagcacatgcaattatgtaaaattcttgtttggatatgaacactgttttaaaagctagattgaactggcggaacaagaaactagctggtt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
52066275 |
catcatcatgaagcacatgcaattatgtaaaattcttgttcggatatgaacactgttttaaaagctagatcgaactggcggaacaagaaactagctggtt |
52066176 |
T |
|
Q |
110 |
tatcggttggtttaattctaattacattgtagtttgtttgaatcacattgaataggatgttgaacccgttcaaccatgcatggttggttcaacca |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52066175 |
tatcggttggtttaattctaattacattgtagcttgtttgaatcacattgaataggatgttgaacccgttcaaccatgcatggttggttcaacca |
52066081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8290 times since January 2019
Visitors: 7802