View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_68 (Length: 270)
Name: NF1711_low_68
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_68 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 12 - 164
Target Start/End: Complemental strand, 16641553 - 16641402
Alignment:
Q |
12 |
ggactctttaaccgttgtaaaattttgttttttccttgagaaacaagtgtcagtcacatgagtagccattaaattcaacaaagtggtggttgtttaatga |
111 |
Q |
|
|
||||||||||||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
16641553 |
ggactctttaacctttgtaaaattttggtatttgtagcagaaacaagtgtcagttacatgagtagccattaaatccaacaa-gtggtggttgtttaatga |
16641455 |
T |
|
Q |
112 |
tccatgagtatccaaggtgttcaaccacgtccacaagagacaaacatacactt |
164 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
16641454 |
tccatgagtatccaaggtgttcagccacgtccacaagagacaaaaatacactt |
16641402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 270
Target Start/End: Complemental strand, 16641213 - 16641168
Alignment:
Q |
225 |
ttagataagatataggaaaaggctgaagtggaaccacctttgcatg |
270 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
T |
16641213 |
ttagataagatataggaaaaggttgaagtggaaccacctctgcatg |
16641168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14771 times since January 2019
Visitors: 8422