View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_72 (Length: 252)
Name: NF1711_low_72
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_72 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 31548894 - 31549139
Alignment:
Q |
1 |
tgcaactcgtcgacaagtttttgttgcccttcaaattctgtccttgtctcgaatacagatacatcagtcacctaacaagaaacatatgcaattaacaaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31548894 |
tgcaactcgtcgacaagtttttgttgcccttcaaattctgtccttgtctcgaatacagatacatcagtcacctaacaagaaacatatgcaattaacaaca |
31548993 |
T |
|
Q |
101 |
tgataatcgttataatggatacgttgaatagctatcctaagctgttacggttctaaatcctac-aaaaacactagtggtttttatatccaatagcatgca |
199 |
Q |
|
|
||||||||| |||||| ||||||||||| | ||||||||||||||| |||||| |||| || |||||||| ||||||||||||||||||||||||||| |
|
|
T |
31548994 |
cgataatcgtaataatgaatacgttgaattacaatcctaagctgttacagttctatatccaacaaaaaacacaagtggtttttatatccaatagcatgca |
31549093 |
T |
|
Q |
200 |
acctttttataaaaagaatgtctttattacctgcaatttcatctct |
245 |
Q |
|
|
|| ||||| | ||||||||||| | ||||||||||||||| ||||| |
|
|
T |
31549094 |
acatttttgtcaaaagaatgtcgtcattacctgcaatttcttctct |
31549139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12896 times since January 2019
Visitors: 8269