View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_75 (Length: 249)
Name: NF1711_low_75
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_75 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 21701306 - 21701069
Alignment:
| Q |
2 |
aggtacctctatttgtcgcggtgcaccttctatttctcatcttctatttgcagatgattgttttatgttttttaaagctgaagaaagtcaggctcatgct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21701306 |
aggtacctctatttgtcgcggtgcaccttctgtttctcatcttctatttgcagatgattgttttctgttttttaaagctgaagaaagtcaggctcatgct |
21701207 |
T |
|
| Q |
102 |
atgaaaaatattctaacggtttatgaggcagtgtcaggccagcctattagtctcccaaaattagagatttactatagtcgtaatgtttcgtctgaattga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || || |||||||||| ||||||| | ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
21701206 |
atgaaaaatattctaacggtttatgaggcagtgtcgggacaagctattagtcttccaaaatcaaagatttactgtagtcgtaatgtttcatctgaattga |
21701107 |
T |
|
| Q |
202 |
aaggtacaatagctgacacaatgggtgtccagtctgtg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21701106 |
aaggtacaatagctgacacaatgggtgtccagtctgtg |
21701069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 34 - 132
Target Start/End: Original strand, 31158962 - 31159060
Alignment:
| Q |
34 |
tttctcatcttctatttgcagatgattgttttatgttttttaaagctgaagaaagtcaggctcatgctatgaaaaatattctaacggtttatgaggcag |
132 |
Q |
| |
|
||||||||||||||||||| || ||||||||| | ||||| ||||||||||| |||||||| |||| |||||| || ||| ||||| |||||||||| |
|
|
| T |
31158962 |
tttctcatcttctatttgcggacgattgttttctttttttcaaagctgaagagagtcaggcccatgttatgaagtctactcttacggtgtatgaggcag |
31159060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 113
Target Start/End: Complemental strand, 10982936 - 10982855
Alignment:
| Q |
32 |
tatttctcatcttctatttgcagatgattgttttatgttttttaaagctgaagaaagtcaggctcatgctatgaaaaatatt |
113 |
Q |
| |
|
|||||| ||||| || |||||||||||||| ||| | ||||||||||| |||| ||||||| || ||||||||||||||| |
|
|
| T |
10982936 |
tatttcgcatctgctctttgcagatgattgctttctattttttaaagcaacagaaggtcaggcccaagctatgaaaaatatt |
10982855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 10396085 - 10396026
Alignment:
| Q |
23 |
tgcaccttctatttctcatcttctatttgcagatgattgttttatgttttttaaagctga |
82 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||| |||||| ||||||| | |||||| |
|
|
| T |
10396085 |
tgcacctactatttctcacctcctatttgcagatgactgttttttgtttttcagagctga |
10396026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9618 times since January 2019
Visitors: 7932