View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_77 (Length: 249)
Name: NF1711_low_77
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_77 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 42010715 - 42010955
Alignment:
Q |
1 |
ctatactttattctcaataggctaatttaaggtatgtctactcactaattatgactgcactttctttcattannnnnnnataaatagttcttaaatatta |
100 |
Q |
|
|
||||| || |||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||| | |||||||||| |||||||||| |
|
|
T |
42010715 |
ctataattcattctcaataggctaatttaaggtatgtctgctcacgaattatgactgcactatctttcatgatttttttataaatagttattaaatatta |
42010814 |
T |
|
Q |
101 |
aatacattgtacagacaaaatgaaaaagactaatatgacatgcttttatatatattttaaatattaaatatgaaagagac---taattttttaggcactt |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
42010815 |
aatacattgtacagacaaaatgaaaaagactaatgtgacatgcttttatatatattttaaatattaaatatgaaagagactagtaattttttaggcactt |
42010914 |
T |
|
Q |
198 |
aattaatggtttacannnnnnnctttggtaaaacacttcat |
238 |
Q |
|
|
||||||||||||||| ||||||||||||||||||| |
|
|
T |
42010915 |
aattaatggtttacatttttttctttggtaaaacacttcat |
42010955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11373 times since January 2019
Visitors: 8091