View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_79 (Length: 248)
Name: NF1711_low_79
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_79 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 33834541 - 33834321
Alignment:
Q |
20 |
aggtatgccttaaaaatttgaaattcggatcagctgtaatcagttactccgcacagtcagcattttggtggccattggattgaaaacagacgatccctcc |
119 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
33834541 |
aggtatgccttaaaaatttgaaattcagatcagctgtaatcagttactccgcacagtcagcattttggtggccattggattgaaatcagacgatccctcc |
33834442 |
T |
|
Q |
120 |
aaaggtcactgatatgctaactgcatgaatgcattatattgccgagcggagacaatccgaatttgaaaatatgtgtagaatttatttgaaatatttatgg |
219 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33834441 |
aaagatcactgatatgctaactgcatgaatgcattatattg-cgagcggagacaatccgaatttgaaaatatgtgtagaatttatttgaaatatttatgg |
33834343 |
T |
|
Q |
220 |
ttatttgattacactattaaac |
241 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
33834342 |
ttatttgattacactattaaac |
33834321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7854 times since January 2019
Visitors: 7737