View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1711_low_82 (Length: 246)

Name: NF1711_low_82
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1711_low_82
NF1711_low_82
[»] chr7 (1 HSPs)
chr7 (1-230)||(10031655-10031885)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 10031885 - 10031655
Alignment:
1 attataaaatatcataatagaactcaagctataagtatttatctgtactttatttcacacnnnnnnn-gtatttatttctaaattatttttatagttaaa 99  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||        ||||||||||||||||||||||||||||||||    
10031885 attataaaatatcataatagaactcaagctataagtatttatttgtactttatttcacacaaaaaaaagtatttatttctaaattatttttatagttaaa 10031786  T
100 gagaaatttcatatttttacatacgttgtaagttcatttcataaatgtttttggagaatttatttatataatcattaatcatggatcaatgacataatag 199  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10031785 gagaaatttcatatttttacataagttgtaagttcatttcataaatgtttttggagaatttatttatataatcattaatcatggatcaatgacataatag 10031686  T
200 atctgcaacgaacttaagatcaacactctct 230  Q
    |||||||||||||||||||||||||||||||    
10031685 atctgcaacgaacttaagatcaacactctct 10031655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16515 times since January 2019
Visitors: 3768