View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_83 (Length: 243)
Name: NF1711_low_83
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_83 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 10596061 - 10595843
Alignment:
Q |
8 |
ataatactctggtggaatccaagccaaagggtatggaaaattcctaaactgaattggaaccatagcatcattctctttcttaccaacatcaggtttttgc |
107 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10596061 |
ataatactctggttgaatccaagccaaagggtatggaaaattcctaaactgaattggaaccatagcatcattctctttcttaccaacatcaggtttttgc |
10595962 |
T |
|
Q |
108 |
tcttccaccttcacagatttgtcttccctttggctgcatgaatgattagaacagccacaacaatgatgttcccttggcatatatttatcatactcgtatc |
207 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10595961 |
tcttccaccttcacagatttgtcttccttttggctgcatgaatgattagaacagccacaacaatgatgttcccttggcatatatttatcatactcgtatc |
10595862 |
T |
|
Q |
208 |
tcggaagctccatgttata |
226 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
10595861 |
tcggaagctccatgttata |
10595843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9174 times since January 2019
Visitors: 7893