View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_88 (Length: 237)
Name: NF1711_low_88
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_88 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21779110 - 21778895
Alignment:
Q |
1 |
aataagggttactttgcaagaagaaaccacctctttctttcagtttctggtgatagagactcttctctaacgaattcagataccatgtttgaatttgaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
21779110 |
aataagggttactttgcaagaagaaaccacctctttctttc------tggtgatagagactcttctctaacggattcagataccatgtttgaatttgaag |
21779017 |
T |
|
Q |
101 |
aatcagacatttacaattccaatcatgctaactccatagagtttcgcaaatctattcatggctctcgcttggccaagaaaccatcttcaccgaagcagaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21779016 |
aatcagacatttacaattccaatcatgctaactccatagagtttcgcaaatctattcatggctctcgcttggccaagaaaccatcttcaccgaagcagaa |
21778917 |
T |
|
Q |
201 |
gcaaatggacgctggagtagct |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
21778916 |
gcaaatggacgctggagtagct |
21778895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8390 times since January 2019
Visitors: 7802