View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_89 (Length: 237)
Name: NF1711_low_89
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_89 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43862233 - 43862017
Alignment:
Q |
1 |
tttcatcgatccatgctaaattccatgacatctaaagaatgtttttcaagtacaaggatcataatattgttaattaatttctacctgcaacatcattaac |
100 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43862233 |
tttcatcgatccatgctaa-ttccatgacatctaaagaatgttttttaagtacaaggatcataatattgttaattaatttctacctgcaacatcattaac |
43862135 |
T |
|
Q |
101 |
atttctacctccaatgtcgtcatctccgtcgtcgtcatcatcatcgtcagagggatcataccctttcccttgttccttgcaagattgattaagaacaggt |
200 |
Q |
|
|
||||||||||||||| |||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
43862134 |
atttctacctccaat---gtcatcgtcctcgtcatcatcatcgtcgtcagagggatcataccctttcccttgttccttgcaatattgattaagaacaggt |
43862038 |
T |
|
Q |
201 |
gcaactgcctcctctccttaa |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
43862037 |
gcaactgcctcctctccttaa |
43862017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11564 times since January 2019
Visitors: 8091