View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_93 (Length: 235)
Name: NF1711_low_93
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_93 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43066959 - 43066723
Alignment:
| Q |
1 |
aaactgaattcaaccggcctttaatttt-gtcaatgaaaagaaaaagtattcaacccacgtgttatgcgaacttgggtatgaaaatgaaaactcatggtc |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43066959 |
aaactgtattcaaccggcctttaatttttgtcaatgaaaagaaaaagtattcaacccacgtgctatgcgaacttgggtatgaaaatggaaactcatggtc |
43066860 |
T |
|
| Q |
100 |
tataa---gttggcatattccaattggttgaaccgtttgacccctcacccaaacattaatcatgcacnnnnnnnnaaggaagtattcatgcacttttatc |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43066859 |
tataatacgttggcatattccaattggttgaaccgtttgccccctcatccaaacattaatcatgcacttttttttaaggaagtattcatgcacttttatc |
43066760 |
T |
|
| Q |
197 |
tacgtattaaatcaagtcatcacgtatatgagatatt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43066759 |
tacgtattaaatcaagtcatcacgtatatgagatatt |
43066723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14000 times since January 2019
Visitors: 8375