View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_96 (Length: 234)
Name: NF1711_low_96
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_96 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 220
Target Start/End: Complemental strand, 18985077 - 18984879
Alignment:
Q |
22 |
caagcttctggatcaatatctgacagtttcttttggtgcagacatttaggtaaaacaagagtggatgaaagtaggagcttgactttagactgcatcagac |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18985077 |
caagcttctggatcaatatctgacagtttcttttggtgcagacatttaggtaaaacaagagtggatgaaagtaggagcttgactttagactgcatcagac |
18984978 |
T |
|
Q |
122 |
actctttgattaggcaggaagatagcataatattcaatcttttggagagagctcaatattcttataatgcagacacatatgacaaagcattcttctcag |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18984977 |
actctttgattaggcaggaagatagcataatattcaatcttttggagagagctcaatattcttataatgcagacacatatgacaaagcattcttctcag |
18984879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13144 times since January 2019
Visitors: 8270