View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1722-Insertion-1 (Length: 89)
Name: NF1722-Insertion-1
Description: NF1722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1722-Insertion-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 8e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 29593837 - 29593766
Alignment:
| Q |
12 |
ggaattaaaagtgggttggcaatgctttgtagtgaaaaacaatggtggttatcagcttcaagtgtagtgcag |
83 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
29593837 |
ggaattaaatgtgggttggcaatgctttgaagtgaaaaacaatggtggttacctgcttcaagtgtagtgcag |
29593766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 12 - 82
Target Start/End: Complemental strand, 29600735 - 29600665
Alignment:
| Q |
12 |
ggaattaaaagtgggttggcaatgctttgtagtgaaaaacaatggtggttatcagcttcaagtgtagtgca |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
29600735 |
ggaattaaaagtgggttggcaatgctttgaagtgaaacagaatgttggttatcagcttcaagtgtagtgca |
29600665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 29752554 - 29752624
Alignment:
| Q |
12 |
ggaattaaaagtgggttggcaatgctttgtagtgaaaaacaatggtggttatcagcttcaagtgtagtgca |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | |||| ||||||||||||| |||||||||||| |
|
|
| T |
29752554 |
ggaattaaaagtgggttggcaatgctttaaagtgaaacagaatgttggttatcagcttgaagtgtagtgca |
29752624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8012 times since January 2019
Visitors: 7737