View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1722-Insertion-4 (Length: 242)
Name: NF1722-Insertion-4
Description: NF1722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1722-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 44651662 - 44651428
Alignment:
| Q |
8 |
catcccgtggagtagcaatgccatcttccgctgtaaccaactagctccggccgtcgtcatcagcctactatggatcatgatgttattaatattatgcagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44651662 |
catcccgtggagtagcaatgccatcttccgccgtaaccaactagctccggccgtcgtcatcagcctactatggatcatgatgttattaatattatgcagt |
44651563 |
T |
|
| Q |
108 |
tttgttgataaatcatatcagtttgattgttgttttgccgtaggtatatacaaaaattgagaaaaaatggttttacccaaaggagatcattatttgtaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44651562 |
tttgttgataaatcatatcagtttgattgttgttttgcggtaggtatatacaaaaattgagaaaaaatgcttttacccaaaggagatcattatttgtaga |
44651463 |
T |
|
| Q |
208 |
atatataatgcactaaattgtttataaacacttca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44651462 |
atatataatgcactaaattgtttataaacacttca |
44651428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 70
Target Start/End: Original strand, 32879176 - 32879232
Alignment:
| Q |
14 |
gtggagtagcaatgccatcttccgctgtaaccaactagctccggccgtcgtcatcag |
70 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| | |||||| ||||||||| |
|
|
| T |
32879176 |
gtggagtagcaatgccatactccgccttaaccaactagtttcggccgacgtcatcag |
32879232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15971 times since January 2019
Visitors: 3757