View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1722_high_5 (Length: 218)
Name: NF1722_high_5
Description: NF1722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1722_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 28 - 200
Target Start/End: Complemental strand, 4951669 - 4951482
Alignment:
| Q |
28 |
taataactttccttctgtaaaaaattcataacttccttgttggcaaactgattgcttggtacaagtgttgtttcttctttaaattaaaaagagccgatca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951669 |
taataactttccttctgtaaaaaattcataacttccttgttggcaaactgattgcttggtacaagtgttgtttcttctttaaattaaaaagagccgatca |
4951570 |
T |
|
| Q |
128 |
ccatc----------ataagtgatttttgaaagag-----nnnnnnngtgatcaatacttatcctcttaatcgcatagtttagagttc |
200 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951569 |
ccatcataatgtaacataagtgatttttgaaagagagaaaaaaaaaagtgatcaatacttatcctcttaatcgcatagtttagagttc |
4951482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9939 times since January 2019
Visitors: 7932