View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723-Insertion-1 (Length: 206)
Name: NF1723-Insertion-1
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723-Insertion-1 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 206
Target Start/End: Complemental strand, 47053862 - 47053664
Alignment:
Q |
8 |
aatgtttggagaaagcttagtgattgtttctcagaagataacattggttagaaacttagaatttcataactcagcgtcgtctaagttccctaagctctat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
47053862 |
aatgtttggagaaagcttagtgattgtttctcagaagataacattggttagaaacttagaatttcataactcagcgtcgtctaagttccctaagctctgt |
47053763 |
T |
|
Q |
108 |
tagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcctttgctccctttctctctttgtttcagttgtga |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47053762 |
tagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcctttgctccctttctctctttgtttcagttgtga |
47053664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8432 times since January 2019
Visitors: 7802