View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_high_11 (Length: 359)
Name: NF1723_high_11
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_high_11 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 27 - 244
Target Start/End: Complemental strand, 8390719 - 8390502
Alignment:
Q |
27 |
cttttgttgttggatttagtctctgttgtaacatcttatttataattgtggagattctgacactttccgtagatgtagacaacattggatgaaccatgtc |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8390719 |
cttttgttgttggatttagtctctgttgtaacatcttatttataattgtagagattctgacactttccgtagatgtagacaacattggatgaaccatgtc |
8390620 |
T |
|
Q |
127 |
ttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaactattagtttgatcatttgtgatacttgattgatatc |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
8390619 |
ttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaacaattagtttgatcatttgtgatacttgattgatatc |
8390520 |
T |
|
Q |
227 |
aaattcctattatgttta |
244 |
Q |
|
|
||||||||||||| |||| |
|
|
T |
8390519 |
aaattcctattatcttta |
8390502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 271
Target Start/End: Original strand, 8421491 - 8421548
Alignment:
Q |
214 |
cttgattgatatcaaattcctattatgtttatgccatgtcaattttcctcttgctgtt |
271 |
Q |
|
|
|||||||||||| || ||||| ||||||| ||||| |||||||||||||||| |||| |
|
|
T |
8421491 |
cttgattgatatgaacttcctcttatgttaatgcctcgtcaattttcctcttgttgtt |
8421548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 143 - 171
Target Start/End: Original strand, 8421418 - 8421446
Alignment:
Q |
143 |
ttttctgtcttctacctaaacagtctatt |
171 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
8421418 |
ttttctgtcttctacctaaacagtctatt |
8421446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9164 times since January 2019
Visitors: 7893