View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_high_36 (Length: 225)
Name: NF1723_high_36
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1723_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 27240041 - 27240151
Alignment:
| Q |
1 |
cttctccagttttctacaatgccccaacagattctcacactccgccgccaatttctgattctcctcaacaaacttttttatcgccaacgcattcacacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27240041 |
cttctccagttttctacaatgccccaacagattctcacactccgccgccaatttctgattctcctcaacaaacttctttatcgccaacgcattcacacac |
27240140 |
T |
|
| Q |
101 |
gcttcatacta |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
27240141 |
gcttcatacta |
27240151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 27217513 - 27217595
Alignment:
| Q |
18 |
aatgccccaacagattctcacactccgccgccaatttctgattctcctcaacaaacttttttatcgccaacgcattcacacac |
100 |
Q |
| |
|
|||| ||||| ||||||||| |||| |||||||||||| ||||||| ||||| |||||| ||||| | || ||| |||||||| |
|
|
| T |
27217513 |
aatgtcccaatagattctcagactctgccgccaatttcagattctcttcaacgaactttattatctctaatgcactcacacac |
27217595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8533 times since January 2019
Visitors: 7803