View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_16 (Length: 322)
Name: NF1723_low_16
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_16 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 43857313 - 43857524
Alignment:
Q |
12 |
tcatcaatagaaaacagtggaatcataacacgatatcaagcaaattttggcatcacaagtcttgaatccacaacct---------agagaacccttattc |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| ||||||||||||||| |
|
|
T |
43857313 |
tcatcaatagaaaacagtggaatcataacacgatatcaaacaaattttggcatcgcatgtcttgaatccacaaccttgaagcagtagagaacccttattc |
43857412 |
T |
|
Q |
103 |
caaactatattcaaagaaaatacaaattgaatataatttcaattttcttttaatgattgataatgattttatggtaacacaaaaacaaacttacaattga |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43857413 |
caaactatattcaaagaaaatacaaattgaatataatttcaattttcttttaatgattgataatgattttatggtaacacaaaaacaaacttacaattga |
43857512 |
T |
|
Q |
203 |
atgtgattaatc |
214 |
Q |
|
|
|||||||||||| |
|
|
T |
43857513 |
atgtgattaatc |
43857524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 4007101 - 4007065
Alignment:
Q |
12 |
tcatcaatagaaaacagtggaatcataacacgatatc |
48 |
Q |
|
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
T |
4007101 |
tcatcaatagaaaatagtggaatcataagacgatatc |
4007065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13441 times since January 2019
Visitors: 8302