View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1723_low_16 (Length: 322)

Name: NF1723_low_16
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1723_low_16
NF1723_low_16
[»] chr7 (1 HSPs)
chr7 (12-214)||(43857313-43857524)
[»] chr8 (1 HSPs)
chr8 (12-48)||(4007065-4007101)


Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 43857313 - 43857524
Alignment:
12 tcatcaatagaaaacagtggaatcataacacgatatcaagcaaattttggcatcacaagtcttgaatccacaacct---------agagaacccttattc 102  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||         |||||||||||||||    
43857313 tcatcaatagaaaacagtggaatcataacacgatatcaaacaaattttggcatcgcatgtcttgaatccacaaccttgaagcagtagagaacccttattc 43857412  T
103 caaactatattcaaagaaaatacaaattgaatataatttcaattttcttttaatgattgataatgattttatggtaacacaaaaacaaacttacaattga 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43857413 caaactatattcaaagaaaatacaaattgaatataatttcaattttcttttaatgattgataatgattttatggtaacacaaaaacaaacttacaattga 43857512  T
203 atgtgattaatc 214  Q
    ||||||||||||    
43857513 atgtgattaatc 43857524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 4007101 - 4007065
Alignment:
12 tcatcaatagaaaacagtggaatcataacacgatatc 48  Q
    |||||||||||||| ||||||||||||| ||||||||    
4007101 tcatcaatagaaaatagtggaatcataagacgatatc 4007065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 13441 times since January 2019
Visitors: 8302