View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_22 (Length: 286)
Name: NF1723_low_22
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_22 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 36 - 266
Target Start/End: Original strand, 20931385 - 20931618
Alignment:
Q |
36 |
caaaggcatagtattaattaagtgaagccgtaattgtgtcaccgactactaaataattggacttaatactccaactccacttgaagtctttaacatttcg |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20931385 |
caaaggcatagtattaattaagtgaagccgtaattgggtcaccgactactaaataattggacttaatactccaactccacttgaagtctttaacatttcg |
20931484 |
T |
|
Q |
136 |
tacgtcactgatgagtgaagctcgtgaaccactcatgagaacaaacaagttgattgcagctaaagcactttcaccttcaagtgtatctgttttcttgtaa |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20931485 |
tacgtcactgatgagtgaagctcgtgaaccactcatgagaacaaacaagttgattgcagctaaagcactttcaccttcaagtgtatctgttttcttgtaa |
20931584 |
T |
|
Q |
236 |
atgaatgaatgaat---ttgttaaatgaatttga |
266 |
Q |
|
|
|||||||||||||| ||||||||||||||||| |
|
|
T |
20931585 |
atgaatgaatgaatgaattgttaaatgaatttga |
20931618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8372 times since January 2019
Visitors: 7802