View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_24 (Length: 276)
Name: NF1723_low_24
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1723_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 40 - 270
Target Start/End: Complemental strand, 17779196 - 17778966
Alignment:
| Q |
40 |
aacatctacatcaaaattttggctatcattgttgttagtgtagaagtggttggccaaggatgtgttctttgtcaatgagatgttgcttgaacaaaattgg |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17779196 |
aacatcttcatcaaaattttggctatcattgttgttagtgtagaagtggttggccaaggatgtgttctttgtcaatgagatgttgcttgaacaaaattgg |
17779097 |
T |
|
| Q |
140 |
gtgatttcttgatttttggttagcatattagaggttcttgtttcagatagggaagaaacccaagagtgagacaaagctctttgagccgtagaatttgttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17779096 |
gtgatttcttgatttttggttagcatattagaggttcttgtttcagatagggaagaaacccaagagtgagacaaagctctttgagccgtagaatttgttt |
17778997 |
T |
|
| Q |
240 |
tcttgaatattctacagatagcctatgattc |
270 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
17778996 |
tcttgaatattctacagatagcccatgattc |
17778966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13155 times since January 2019
Visitors: 8270