View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_25 (Length: 275)
Name: NF1723_low_25
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_25 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 66 - 155
Target Start/End: Complemental strand, 26410320 - 26410231
Alignment:
Q |
66 |
ccacgtgaggtttcttggttttggccatatgtttaatgatgttgttgaaaatggaaagaacaggaataagaatagtaattgtagtaacat |
155 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26410320 |
ccacgtgaggtttcttggttttggccatatgtttaatgatgttgttgaaaatggaaagaacaggaataagaatagtaattgtagtaacat |
26410231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 227 - 267
Target Start/End: Complemental strand, 26410159 - 26410119
Alignment:
Q |
227 |
gtgtgatatttatggaggatttgcatggtggggatgatgtc |
267 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
26410159 |
gtgtggtatttatggaggatttgcatggtggggatgatgtc |
26410119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13718 times since January 2019
Visitors: 8302