View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1723_low_25 (Length: 275)

Name: NF1723_low_25
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1723_low_25
NF1723_low_25
[»] chr2 (2 HSPs)
chr2 (66-155)||(26410231-26410320)
chr2 (227-267)||(26410119-26410159)


Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 66 - 155
Target Start/End: Complemental strand, 26410320 - 26410231
Alignment:
66 ccacgtgaggtttcttggttttggccatatgtttaatgatgttgttgaaaatggaaagaacaggaataagaatagtaattgtagtaacat 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26410320 ccacgtgaggtttcttggttttggccatatgtttaatgatgttgttgaaaatggaaagaacaggaataagaatagtaattgtagtaacat 26410231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 227 - 267
Target Start/End: Complemental strand, 26410159 - 26410119
Alignment:
227 gtgtgatatttatggaggatttgcatggtggggatgatgtc 267  Q
    ||||| |||||||||||||||||||||||||||||||||||    
26410159 gtgtggtatttatggaggatttgcatggtggggatgatgtc 26410119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 13718 times since January 2019
Visitors: 8302