View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_26 (Length: 273)
Name: NF1723_low_26
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_26 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 135 - 260
Target Start/End: Complemental strand, 50308023 - 50307898
Alignment:
Q |
135 |
gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttcttggtttgtatccgtattttcatttt |
234 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
T |
50308023 |
gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttcttggtttgtatccgtattctcatttt |
50307924 |
T |
|
Q |
235 |
ggtcttgattatcttcatgttcatct |
260 |
Q |
|
|
| |||||||||||||||||||||||| |
|
|
T |
50307923 |
gatcttgattatcttcatgttcatct |
50307898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13502 times since January 2019
Visitors: 8302