View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_32 (Length: 243)
Name: NF1723_low_32
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1723_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 11723251 - 11723032
Alignment:
| Q |
1 |
tttgctcctctgcaagtcggactatgctccctcgttgcctcccttcgctatcagctcgtatctatcttgacggttgcttccttcggtacgataattatag |
100 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
11723251 |
tttgctacgctgcaagtcggactatgctccctcgttgcctcccttcgctatcagctcgtatttatcttgatggttgcttccttcgttacgataattatag |
11723152 |
T |
|
| Q |
101 |
tttctactcagaggaaactgaccttttgagggataaaataatttgcacctcttctgagaggttggaggtgcagatggaaaggagtgttgaaagagtggtt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11723151 |
tttctactcagaggaaactgaccctttgagggataaagtaatttgcacctcttctgagaggttggaggtgcagatggaaaggagtgttgaaagagtggtt |
11723052 |
T |
|
| Q |
201 |
gatgctgtggccaaggatgc |
220 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
11723051 |
gatgttgtggccaaggatgc |
11723032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7753 times since January 2019
Visitors: 7737