View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_37 (Length: 226)
Name: NF1723_low_37
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_37 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 8438903 - 8439098
Alignment:
Q |
15 |
atgaatgtgatgatcggacataggggcaaacccctatttattttatttctaagttttgtgcaggttgtttctatcttttacttagataatcgtttcaagc |
114 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8438903 |
atgaatgtgatgatcagacataggggcaaacccctatttattgtatttctaagttttgtgcaggttgtttctatcttt-acttagataatcgtttcaagc |
8439001 |
T |
|
Q |
115 |
caatgatattgtaaataagcttaaggaattcacttctttcagctgggacccaatccattttaaaataattgtaaaagatgtgttaagtggtgatttt |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
T |
8439002 |
caatgatattgtaaataagcttaaggaattcacttctttcagctgggacccaatccattttaaaataattgtaaaagatttgttcagtggtgatttt |
8439098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13651 times since January 2019
Visitors: 8302