View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_40 (Length: 223)
Name: NF1723_low_40
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_low_40 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 2752919 - 2752708
Alignment:
Q |
1 |
aatgaaagaaggaaagagaaaaatatcgccattggaaagattagagccaccatgggtgttggaaagtctatcaattctactttgggcaaaaataaatgta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2752919 |
aatgaaagaaggaaagagaaaaatatcgccattggaaagattagagccaccatgggtgttggaaagtctatcaattctactttgggcaaaaataaatgta |
2752820 |
T |
|
Q |
101 |
acaggatttctccacttacattttg-----atttcatgattattcaattttggtaattttatgatttacgtatgcatgcaagatgtttaatgttagattc |
195 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2752819 |
acaggatttctccacttacattttgatttgatttcatgattattcaattttggtaattttatgatttacgtatgcatgcaagatgtttaatgttagattc |
2752720 |
T |
|
Q |
196 |
aaagatgtcatt |
207 |
Q |
|
|
|||||||||||| |
|
|
T |
2752719 |
aaagatgtcatt |
2752708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12679 times since January 2019
Visitors: 8223