View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_low_8 (Length: 406)
Name: NF1723_low_8
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1723_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 8 - 393
Target Start/End: Complemental strand, 55329678 - 55329287
Alignment:
| Q |
8 |
catcatcaagaagtttgatattagagttgttgttctt------cttctcgagaagcagtgttttggtaatcaaattacagaaaagatagacaaattgaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329678 |
catcatcaagaagtttgatattagagttgttgttgttgttgttcttctcgagaagcagtgttttggtaatcaaattacagaaaagatagacaaattgaac |
55329579 |
T |
|
| Q |
102 |
agaggggttaacgggaatgggataagcaatgcggctgaaagtatggagaggcatagcagaatcaacaagagcgacaattggaatgtgaagtttgaaagcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329578 |
agaggggttaacgggaatgggataagcaatgcggctgaaagtatggagaggcatagcagaatcaacaagagcgacaattggaatgtgaagtttgaaagcc |
55329479 |
T |
|
| Q |
202 |
tcgtcaataacagaagacttgctctcggtatcgacaatgacgatgcaatcgggaggctgagtgggaccgaagcaaagtttcttgttgcgagatcgaaact |
301 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329478 |
tcgtcaataacagaagacttgctctcagtatcgacaatgacgatgcaatcgggaggctgagtgggaccgaagcaaagtttcttgttgcgagatcgaaact |
55329379 |
T |
|
| Q |
302 |
tcttgggactgttgctgttggtgagaaatccaccagtacgccagagagaattggaagagggactgtagcatccaacctttttggacataagt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329378 |
tcttgggactgttgctgttggtgagaaatccaccagtacgccagagagaattggaagagggactgtagcatccaacctttttggacataagt |
55329287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16306 times since January 2019
Visitors: 3768