View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1735_high_4 (Length: 249)
Name: NF1735_high_4
Description: NF1735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1735_high_4 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 327785 - 328020
Alignment:
Q |
1 |
ctgcaacaacaatattttggccgcatcttgtggtcaacaatttaaaaccatagatgaagttgtacgaatctctaaaacttttatatcgcggtcacaattg |
100 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
T |
327785 |
ctgcaacaacaatattttggctgcatcttgtggtccacaatttaaaaccctagatgaagttgtacgaatctctaaaacttttatattgctgtcacaattg |
327884 |
T |
|
Q |
101 |
cggttagaataccacaatttagaatttattttttaaagaaattattgttagtannnnnnnnnctttcatcaatgtctgatgattaattgtgtaattaact |
200 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
327885 |
cggttagaataccacaatttagaattt-ttttttaaagaaattattgttagtatttttttttctttcatcaatgtctgatgattaattgtgtaattaact |
327983 |
T |
|
Q |
201 |
attaatggaaaaatttatggatgaatgaatgcagaat |
237 |
Q |
|
|
|||||||||| ||| ||||||||||||||||||||| |
|
|
T |
327984 |
attaatggaatgattaatggatgaatgaatgcagaat |
328020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11950 times since January 2019
Visitors: 8179