View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1735_low_4 (Length: 254)
Name: NF1735_low_4
Description: NF1735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1735_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 29642778 - 29642997
Alignment:
| Q |
1 |
tttatgtgaacgttgataacttgcaggattgcttaaggccagtatcaacaaacacctttgaaaatgggagagataaccaatatcagtgagtatgaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29642778 |
tttatgtgaacgttgataacttgcaggattgcttaaggccagtatcaacaaacacctttgaaaatgggagagataaccaatatcagtgagtatgaggaaa |
29642877 |
T |
|
| Q |
101 |
ttgcaaggcagaaattgccaaagatggcatttgactactatgcatctggtgctgaggaccagtggactctccaagaaaacagaaatgccttttccagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29642878 |
ttgcaaggcagaaattgccaaagatggcatttgactactatgcatctggtgctgaggaccagtggactctccaagaaaacagaaatgccttttccagaat |
29642977 |
T |
|
| Q |
201 |
tttgtaagattttatataat |
220 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
29642978 |
tttgtaagatttcatataat |
29642997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11239 times since January 2019
Visitors: 8059