View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1859C-Insertion-12 (Length: 441)
Name: NF1859C-Insertion-12
Description: NF1859C
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1859C-Insertion-12 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 5 - 84
Target Start/End: Original strand, 22342922 - 22343000
Alignment:
Q |
5 |
acatgaatgtattcttacattggtttggtcatagagtgttatataaaaaataacagtgtccttcataactatagctactt |
84 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
22342922 |
acatgaatgtattcttacattg-tttggtcatagagtgttatataaaaaataacaatgtacttcataactatagctactt |
22343000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13679 times since January 2019
Visitors: 8302