View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-11 (Length: 56)
Name: NF1883-3-Insertion-11
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-11 |
| |
|
[»] scaffold0519 (1 HSPs) |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0519 (Bit Score: 56; Significance: 4e-24; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 56; E-Value: 4e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 3234 - 3289
Alignment:
Q |
1 |
tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta |
56 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3234 |
tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta |
3289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 4e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 11231219 - 11231164
Alignment:
Q |
1 |
tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta |
56 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11231219 |
tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta |
11231164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 43171 times since January 2019
Visitors: 7188