View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-21 (Length: 37)

Name: NF1883-3-Insertion-21
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-21
NF1883-3-Insertion-21
[»] chr7 (2 HSPs)
chr7 (1-37)||(21773151-21773187)
chr7 (1-37)||(21786679-21786715)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.0000000000005; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 21773151 - 21773187
Alignment:
1 aaaaggtcaagatgatgacataccggaacatacaaga 37  Q
    |||||||||||||||||||||||||||||||||||||    
21773151 aaaaggtcaagatgatgacataccggaacatacaaga 21773187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 21786679 - 21786715
Alignment:
1 aaaaggtcaagatgatgacataccggaacatacaaga 37  Q
    |||||||||||||||||||||||||||||||||||||    
21786679 aaaaggtcaagatgatgacataccggaacatacaaga 21786715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3426 times since January 2019
Visitors: 5832