View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-25 (Length: 40)
Name: NF1883-3-Insertion-25
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-3-Insertion-25 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 40
Target Start/End: Original strand, 28461108 - 28461143
Alignment:
| Q |
5 |
taaataagactatcatgttctcaaattactatgttt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28461108 |
taaataagactatcatgttctcaaattactatgttt |
28461143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 619 times since January 2019
Visitors: 7436