View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-9 (Length: 141)
Name: NF1883-3-Insertion-9
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-3-Insertion-9 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 25 - 141
Target Start/End: Original strand, 13765831 - 13765947
Alignment:
| Q |
25 |
gcaaacaagtctcttaatagagaatagcgatgtctgtagtcttggggttgtcctatcagagttagagttactcacaggatagaaatcactatctttttac |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13765831 |
gcaaacaagtctcttaatagagaatagcgatgtctgtagtcttggggttgtcctagctgagttagagttactcacaggatagaaatcactatctttttac |
13765930 |
T |
|
| Q |
125 |
aggctattggtataaag |
141 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13765931 |
aggctattggtataaag |
13765947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 14153227 - 14153195
Alignment:
| Q |
16 |
agaatacttgcaaacaagtctcttaatagagaa |
48 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
14153227 |
agaatacttgcaaacaagtgtcttaatagagaa |
14153195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10696 times since January 2019
Visitors: 8495