View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071-Insertion-14 (Length: 358)
Name: NF2071-Insertion-14
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071-Insertion-14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 55 - 272
Target Start/End: Original strand, 413171 - 413388
Alignment:
| Q |
55 |
tgatgaagaaatatccatcctttcagaaaaacttgaaaatggcaggcttaccattaatgataatttgatgtaacactggcctctagatatagatacatac |
154 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
413171 |
tgattaagaaatatccatcctttcagaaaaacttgaaaatggcaggcttaccattaatgataatttgatgtaacactggcctctagatatagatatatac |
413270 |
T |
|
| Q |
155 |
gtgtcgagtccagttttcattgtttgcactatccatccattaggaatatatgcaccacatgggttggagttttctttgtggtaaaagaatgctattcagt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
413271 |
gtgtcgagtccagttttcattgtttgcaccatccatccattaggaatatatgcaccacatgggttggagttttctttgtggtaaaagaatgctatttagt |
413370 |
T |
|
| Q |
255 |
ttaggtcaattagataaa |
272 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
413371 |
ttatgtcaattagataaa |
413388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12906 times since January 2019
Visitors: 8269