View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071-Insertion-17 (Length: 232)
Name: NF2071-Insertion-17
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071-Insertion-17 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 35244319 - 35244531
Alignment:
| Q |
20 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35244319 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
35244418 |
T |
|
| Q |
120 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35244419 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
35244518 |
T |
|
| Q |
220 |
caaggtatttatg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35244519 |
caaggtatttatg |
35244531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 98
Target Start/End: Original strand, 35242275 - 35242350
Alignment:
| Q |
22 |
tgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtct |
98 |
Q |
| |
|
|||| |||||||||| ||| ||||||||| | ||||||| ||||||| ||||||| ||| ||| |||||||||||| |
|
|
| T |
35242275 |
tgataataatgtatggacacaaatacatgagagtataaaattaataag-ttttcaggcataactcggtaggttgtct |
35242350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13113 times since January 2019
Visitors: 8270