View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071-Insertion-21 (Length: 61)
Name: NF2071-Insertion-21
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071-Insertion-21 |
| |
|
[»] scaffold0026 (2 HSPs) |
| |
|
[»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0026 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 101199 - 101146
Alignment:
Q |
8 |
cagttgatcatgagcttctttcatttcagctttgatggcattggccagctgatc |
61 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
101199 |
cagttgatcatgagcttctttcatttcagctttgatggcattggccagccgatc |
101146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 103330 - 103289
Alignment:
Q |
20 |
agcttctttcatttcagctttgatggcattggccagctgatc |
61 |
Q |
|
|
||||| ||||||||||||||||||||||||||| || ||||| |
|
|
T |
103330 |
agcttttttcatttcagctttgatggcattggcgagttgatc |
103289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 25849222 - 25849271
Alignment:
Q |
12 |
tgatcatgagcttctttcatttcagctttgatggcattggccagctgatc |
61 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
T |
25849222 |
tgatcatgagcttctttcatttcaactttgatggcattggcaagctgatc |
25849271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 61
Target Start/End: Original strand, 25847178 - 25847213
Alignment:
Q |
26 |
tttcatttcagctttgatggcattggccagctgatc |
61 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
25847178 |
tttcatttcagctttgatggcattggccagttgatc |
25847213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14113 times since January 2019
Visitors: 8375