View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071-Insertion-22 (Length: 50)
Name: NF2071-Insertion-22
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071-Insertion-22 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 1e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 41876320 - 41876276
Alignment:
Q |
6 |
cagctaatgctactcccgatgccataccaccgcctacaattttca |
50 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41876320 |
cagctaatgctactcccgatgccataccaccgcctacaattttca |
41876276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14820 times since January 2019
Visitors: 8422