View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_101 (Length: 234)
Name: NF2071_high_101
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_101 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 219
Target Start/End: Complemental strand, 42614444 - 42614246
Alignment:
Q |
21 |
catgcatgacatatggtaagaataacacctacttatatcgatgttaaatttagtatgcatatttatattttacgtaagtatttttcaataaacaaagatt |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42614444 |
catgcatgacatatggtaagaataacacctacttatatcgatgttaaatttagtatgcatatttatattttacgtaagtatttttcaataaacaaagatt |
42614345 |
T |
|
Q |
121 |
gggtacatagattaacatcctaatattgtattatcatttatgtcagatgataaactattaagatcctgacagttttaaatagttcgccttatacctttg |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
T |
42614344 |
gggtacatagattaacatcctaatattgtattatcatttatgtcagatgataaactattaagatccggacagttttaaatagttcgccttatacttttg |
42614246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13241 times since January 2019
Visitors: 8270